Text in String Arrays

When you are working with text, enclose sequences of characters in double quotes. You can assign text to a variable.

t ="Hello, world";

If the text includes double quotes, use two double quotes within the definition.

q ="Something ""quoted"" and something else."

q = "Something "quoted" and something else."

tandqare arrays, like all MATLAB^®variables. Theirclassor data type isstring.

whost

Name Size Bytes Class Attributes t 1x1 174 string

To add text to the end of a string, use the plus operator,+.

f = 71; c = (f-32)/1.8; tempText ="Temperature is "+ c +"C"

tempText = "Temperature is 21.6667C"

Similar to numeric arrays, string arrays can have multiple elements. Use thestrlengthfunction to find the length of each string within an array.

A = ["a","bb","ccc";"dddd","eeeeee","fffffff"]

A = 2×3 string array "a" "bb" "ccc" "dddd" "eeeeee" "fffffff"

strlength(A)

ans = 1 2 3 4 6 7

Data in Character Arrays

Sometimes characters represent data that does not correspond to text, such as a DNA sequence. You can store this type of data in a character array, which has data typechar. Character arrays use single quotes.

seq ='GCTAGAATCC'; whosseq

Name Size Bytes Class Attributes seq 1x10 20 char

Each element of the array contains a single character.

seq(4)

ans = 'A'

Concatenate character arrays with square brackets, just as you concatenate numeric arrays.

seq2 = [seq'ATTAGAAACC']

seq2 = 'GCTAGAATCCATTAGAAACC'

Character arrays are common in programs that were written before the introduction of double quotes for string creation in R2017a. All MATLAB functions that acceptstringdata also acceptchardata, and vice versa.